%PDF-1.4 % %PDF-1.4 % 3 0 obj <> /Contents 4 0 R>> endobj 4 0 obj <> stream xURAm\it{RPHv$XJ`•[ӓd A4tOǹ>B >TJ=hҫfCZxO gc}%Ԝ>}w&U6lg.M+GslF@GQ虸-q.NęOϩy X@)sJLT}P.m tPTYQRJTcr&.^pXx`".ǎ#Xx rczl)u']]5oJ|{ߚVt)1+4W.Hŵ},.VXGd:bz+1j,]M([m`>͢]T<v78᧏~`/W9 ,Hpʻ,;5^:ec-uuWk(cHp8aP7,q%9$%<宱rWWҤ\qNz ]t*oߠ&3ЃH̑=!5jgy^x6zjWU==Ll`בܷRVFy3)~w6˜)MB+u̡PkE5q؊w,;To] ֎5-;C+n kS\WO9/Ga3uAcL1g0V3 Hb̤1 endstream endobj 1 0 obj <> endobj 5 0 obj <> endobj 6 0 obj <> endobj 7 0 obj <> endobj 8 0 obj <> endobj 9 0 obj <> endobj 10 0 obj <> stream /CIDInit /ProcSet findresource begin 12 dict begin begincmap /CIDSystemInfo <> def /CMapName /Adobe-Identity-UCS def /CMapType 2 def 1 begincodespacerange <0000> endcodespacerange 1 beginbfrange <0000> <0000> endbfrange endcmap CMapName currentdict /CMap defineresource pop end end endstream endobj 11 0 obj <> endobj 12 0 obj < >> /FontFile2 14 0 R >> endobj 13 0 obj <> stream xŎPEѝҸt7? 5ܪTЄ&6MijӚތf6in߂-iiZފVխimZ߆66Ҧ6mk{;ٮvk:ءwx':٩Nw|إ.7X]j׺ލnvn߃=izދ^jz7l}Sq/)_  endstream endobj 14 0 obj <> stream x{gx\1="6 %[L7- [`KFB%J1%4C=-1b'B:w]ن}^/r=#ơBt=@ѯƣ4F`+J#stNtq:Α WiҮx(Bj/JDл?JB@4 FC{h(Q 2 #2(!3F20؈r ~Ъ !GDx}&:6.cBiXb-_ۿۮi|X صs7#ZlѪ5WUQqaijF"nO4*t>ū<yX`Ͼq qo$$+*Znn.ujPJggx0(=a< _`W뀇N]z^ ^PCkڒz_\}dzڽz~/Eǯsȑu$Lu=sF8\~Q]{aQE l<+`,bq49a}RȰݤW(mX8͒=">:O,-fFOK?Pb9//0:}[~IaIzRg{8M|N\]҆ ⷐCp\ゼ1_n?);y-[3=?:L0QHlW:BGJ|{HC0() X\^ tݧr9 ^ )oc3㹨r3hƠ, O8y#e;7(q%Aq[\7$ߨJiAX!~ hׇp>xKmq"rn}=1 d5nX%"gP I1X8[0&Q63w=-@m6댸3ojP:>ygK/"@,󟱠߰FQs1ݲvSLj]lcO M<LKe=?Xy\sy󋩓}1iܱ#⪩;k _-ӽbFd}@z=)? (n:7¿;q#G&/7 7"+krC04U)?XI~He]#{\Z7m}}t?HD\k>HI'#>{w#Iǎɓ ,Ir })8$8iu*6!.;Bzy5a_mi݅yeKh䍛 xх FϧKMOZv-gWC/zH "n_ct1d0f0Yy6P95 i򞒳.cٹs73d*شr,\pzwN?PntvuK]ͱdΙkpS d[wg>حl7C~9Q tZ>Siǚu~aze7Y,y6efBlwqt}FN>Kpd!1sby㸉Er OL WFHYֶDCתiBf!yUCnpgRW;BS+wG H= ~7N9,T#d#:E!اX+,F6f?")'JqL3)n1}ȅi+B4uU)~|?. t Cw:N}Q[痗{3[7|e<;P3tqY@0FQ}@^A\OB(5I'hLуAC337Ĥ%kr}ϵ1F~rnԅԩ{vcߏCg揞5\۝d ~mc'`} w9\|F ?p9Х.U7𻖇b1\ppRU*JF+ʆ[<@!X[~-ByVNZj"mz??LZ-2XJ+os=0g_#iL/?9a/#G"{Biѫ.9G8ܧ?>х}הi.<ݞ\.yJ~}ЇŏhA ?N7q{F>!?+ SIYG& C/&WڦuZTn4Aq2pik5J) .]OWaء܀^43-qInd6㘧g&'f}󙍷82%vlRvm|ru+zd=\P^lV*+-~(ޗ&+.ť76ɵ~R(Y/aXJg*_m`|T+?raL(jݱ 7\:yHBRon4&7cmDX+> bRjva7eh}p: j}IP1v )/owHY{{e3:nJWOأ;AݡԂZM9 &oJ[XX0 w^IϦ͐:H ~roC-\s柎'KH#Ncf0KZF;~i}h1~{|1i.uJ[Sr9q\rFa_/ޑu!KOL ڞAw.ށL]yO d2pEۣ%BVM"e˖aU]i`@~/V:P;|Az}Qf_Z77䄚g}>HpC\i}VgS)!B1ax3`$tl]"=pI 6j2}N؝ /:D*vHc;XU\>u ~&7"|gD7_L/; )Ȑy<B4cܷW$¬b4Xe&O8 >#vO={v޾#J@<V:,\3nFlM2榁oMuWۂpͽ*֒kr-8tsԍp‰<* ċ{QJchfNI܈nFt %]cthԦ4BŊpח[>q΄UKz)Qt9BKSBއ%RFWR™e*-wlNy- kyYNY}B"t;_3]OezVx beYM/j(dRFZ!6̚&|/sHi〗 ^/H*-3fսRnNK mRy?#h^և%MCZRXě#rpr#x)sa%3QR+l4sNgmi!\X8yB!KBE99o(=mKJ0NZXl* b嵀疽=RpM8|m+0∊r^a<ɗ}jÒάaa99(dvqޡ_\Ђ8Zxý[Ԏ!GݶrZ^WǤr:{l>Kb6)M7έ{.u.uϸ$1#ճAФڹsm;B{p[s{.M j'[ ڳBĶ-Kg^@qOn4j%8Рo݁I=q-iȕT5 TParwҵst5Uq(ӓҀ 47:wxGLT| <_cp 9 3P@%z?dX)UjZTߗd?A"C̝,&om+s-\i/Z:µc~M|-) k@V8Y6X PicJ0t?x6!,?9m\i/|cpWsȏWbr~d3wP-i@S\~&IK8{{!rn9w䏽Vqw)LH?a? .>((:ƸVi?r-V8R+J9.{_7bfs/fqn,Lh}tYn(Ccg j wg/;tբ|_WI y L7' ?GӳZ:^8/ӕō~.+VYH!=*@I|ۊCRWא>*d='ލC`anRѡ瘟1fߑB[6U*qn#_"#xJR~.zZF~ }X4 E6EcEN- 1 sZFQ~5*,GF/S(Kx;"}?l~] hs*z8 @u'"E)h0.pDSCoA)yV.+ק0vug'PM834ۍvQ*rUU x_WmBV a\4BU^@O4 'Zqț`{Fu]iXB[A9!B\n&r_rp??_ FaD&nqJP5SS%fVΨ~TUc)iBs}%ݑ{c]u=zxdzl83ҳs.χ^ub2ym:w h|_y}F5װ(q_5LQľ\`(ƬM%^5xj%QHisw۠yV -xV!?Vf\0DEִL7iZ ᚶ95aLv-dy}Q' Xhf C&<UlLO {&9+U5-h-H t AV@o$C#3ni"<ҨכuLlۊFxT/2;yVa/UaVedX`Ǥa- jt*+64h?`Mh:ْ-`՘dÖl4e$FjëAvŨDp#p- gf_9-#"rrr“)p5#A+0O E\"dh3%d: [\~SXg`6Eb5|_7@ˢHF7I0+j?Qv4$Ǵ38KakFf+F]:vɰ Sz+UR2͔-8VXsYEf&pn? PAf*sh̵Tae++àlJ"}&&v$e,ǴLڝRpeۘVUu2,ՐP}l;YAѲ -t^fT&M?>e)hʞl@-fe eT3&'-Sd:RB+ag^L<.eFA7γHu# qV&зq+v}afhB?قչM\JFwf6~u:g6 Ud]M ۩LtEdw(bJe`VѓFC+=`ʅ&e>6+f*̞#F)l4 s]]1\=*_0ISe]lTeuWfkf\Hg=.ob8sEٙꗧ2UÿȚJ Xn,:d7*Ppf`QǗcj/|_Tjp&.TUyӤdʽkvU!g,FFʚ%2LJ*zjPu&bgcbZO1gzIl#Qӣgb[jMv"R=+e8ld˰% & ij32L`jMeŦW΀}HIe75vk)=q0L%Ua5 d$l'Lv*k;rm&Mj2m_BiX-2vg_ $5dS=T i6$@1$iLV:m&!=HàrӬ9 !heйeHN5JC $l)lp5S͎tM2m(5=ː [T`b6jQ|A̲eZ5hnSdWG(/1*U2S`[̗u0eҩjJ ښd'YSm SFJ13嘁)76v` 30JSȀ963JF+(b:5L\5ID`ghb2=ͨpN|0YLb& El,F8k:LjjֳYFL&%قbZB+bj(z7 .h3A 01=VC,#j10i⡮r).ouM> endobj 16 0 obj <> endobj 17 0 obj <> stream /CIDInit /ProcSet findresource begin 12 dict begin begincmap /CIDSystemInfo <> def /CMapName /Adobe-Identity-UCS def /CMapType 2 def 1 begincodespacerange <0000> endcodespacerange 1 beginbfrange <0000> <0000> endbfrange endcmap CMapName currentdict /CMap defineresource pop end end endstream endobj 18 0 obj <> endobj 19 0 obj < >> /FontFile2 21 0 R >> endobj 20 0 obj <> stream xWNDћ(*XA+V슽c0x$wj@kZPZ߆icܖx;ٮvk:D:ܑ&j4\ǚx':٩Nwv]bZrWڵwvKn߃=izދ{٫^}ا>#~ *_;C endstream endobj 21 0 obj <> stream x[{`֟MɛB6IU(@QDB`۔$V* A*FR^GA x/TwfvT{vwvv<̙M@!!%d~ߡgcyp4˶y jka$"vn~̃qزPWyjt4n p&'[T~ z6iAH?ϳhB1.ߖlcc PxkO"3f Ƣ,$!QJ#3 O-cjⷒ|~+u¯gbTPo0ng̯"Z @L>DW`k]Rtm8`4f BP#"- C(E(jZV5գd@m(š(CQJDF lcA)ȊRQ:N(uF]PW uGzިAꏠh20(z G#h$@ѓh W0hK@"Bi4ȢkqDŜjM5hKWl1GEFhbMIM늕gEbKyLOkZϞi=V=;;Ukc{kaw6IӓMIͱi9'w0d0gUNp`MI5GE|S111RYm:2&YOV؅x.s Z ;^INm2hO:Aq p~ igq<>iz>54c2ɣBvj.7>.C;i|F|؈?0Ҏ4H2XcYZhm3kZ-Qb"Z)qڮm-I4THˇvbA2KWWiǧxk;~Y *]^IWf,/M'O+V>g^Ay_xd̔aI;HIw7&hE!E4EҎ mD%g!ftLLt>11McXD|ƖdDk~e>dgXD҆"3ĐP! OPي߼uɪ~/ӕLÓy7 GB^];(~JIF=E`>|2VaNq0˲pKjK9o #}=mg9??xQؐmx o\1k#GYvz$bD{*/ؗ{V)xτvɂH|WN/$|GkF9f@lNn]/as]3 طd֪ۇ޿zW:Tu*ggޮ8my'>iwOZ|U݆}wތ :dLXUlȽ)WQ`Z̐‹ unòzzcٗ-W~4I޳͈CfnijP}׎vV.ÉճwL* ;;)ܛ1`_?ӫ B1DhCZ|4w 7=O`= |-g bkYG\ZfI jk<.MBRҧh(a.0ƻ[9Y>E%rA4w$ʇ:BkmE~ai[bC Fh~ͳc M]O7oTm׋;}Ї#mv!i56˨mY -=z(-`` :|挶X-ZumْJ"5b5%0-럟䵜͸W.~_[0f,}ri 1>hzަ'?/:' GZǧ6>0auzǝ5.]Flʟpe8ps ڹ|w3.LgJaܕMkI7p/6~ |Db,יm^UtуlPmE|\3lDzY*'k}f^],fVb_ϱ;e1J"&w^x|ri>퍽o곻O)= a¢]Lwg~+zɳj5uI,ZaG33ysi" @,m0NS4YM$y$9)%˥z۬SlcS lNfcMGFzA g?) fpk"$Aߢt= '=T0ArsR2qiCЃy\LJp 0gsT g 4..)uWp\,%CP'/lC$Pէ/}7|"3Vm?Lgv)wޤq3|b35M#;L4lqSťeУ.\5 Xc،_<͹CkYHgi$XWW& RW{Wj!O#EqtcXw\P,J2k+4Sƍš~f[7Zk'g)ˏY\rr;eg?Y}/Sr"LR'#ROŞ7J@aL(:C[j [jF/fׄ ·>>B<t IH*MiK4G8`qe0!i&qLE ?pWK;Ȭ>r5ˠoLw҅e|WX雋\AzIx2MdF4mQ311t:irτI+/b5+hnچOntx՚@xr?RƾӨ뷀!PFǂ_GBI/h p9h5} OzNH?YrFWD7Zcv_  %yCزKzb2\"ǫ~'ޛ/Of}M/\%ڝFR=YQx}HWfgvB>{/wȂ┪[ _p^VmL6aw+d1s]ӑ'cټ`0+ʞ UX%37>jhˋt?ns_7^PAɂ/ږz{єel7#oƛ>'8J Q[2ٛp  434C+K5M. |4>kGVI|bͥqAgBLyJYyt߶Y+T[Κ(h{[{o>9h)P9V.P iCBi4*&РI@U1qVx7 omպȄԖg: Q}EzۡɊ]P`VN4Bm- ~"^DjfPmw¯mj[DxږP+ImkPFmLQ)S~_mBA *`hS!7v(j6YmkQDrb$Z>7yo.|tH'F9ȋ<W\'9 F:s)EQPϷu:3;ѹ{aBPwԆQݰ^NOA nAXczݶ\F~t99M1Y7],bd~6[%^tdLβX33ҙD.ABpt knvXit@[vN̎\HFOA L|]-]:Gg,G5_`N( >zy x&Md1 F+/A?Ȧʄ'=ŝ8^<\ Ų^V8,-trSv f:a~6ާ s Ռ# v+}K4n˂[cpuQN@PI.QCMm 7Vf3?MMŔMλȣj[f['_G' Ql8 ^f#\[aB[ݗ):9%rye ?|=;3UL 2.\YgQpf[ǿd"G9j|1—W|h_=_PUMiƟ/6q% r()Ylu9>A7.^&sԥȗ 7\E|T >2hHfÙeٻn `oC-.^{u^uv;y0?Ŷ)ugF]FdCWqd<\Gn1`w;l^g~.e* :g>8fwx|=;v ܮB;&3|sPpVx=^G'Agtmc撃4l7ɞ[ŸC & C#/g-z :pNʇYlזg%7)GgՖz#\`5U_0 .h α"T8銁 ;l' F|pu ؜ەyci: < d@In'JY.P$Upq.`|8 7 {lƜ߆-OTdLJ g(VũgN]F]"znDgpfx3?ۂaYB}fj:z7>hsA Tup=\BYl wTnc c@%z-j?f'k endstream endobj 22 0 obj <> stream JFIF``C     C   ^^"  DHH2"@P%@( D  @ "f %gϠ!"! %Qs=>LĈDĄ @ D L @zuCQ;oͶRo~ͳzDH@L @gȔD D6|QRZgz [TVS+ܭ{}'L:-:58SysUv7>dF#(lH$iaJTS(Lmus\WEc^0ñYtAێg}4&V畜u^4g/0W8}s^v7A".<y:kK_WJ4n-7fM\,Խk?2dc}k6+.c9yOI%Grepb>0ƐyL͞㡝bpRqD^wist_(\oe fN앹v\篟:gX5*Mѫvns@֡j瘟'zw͹No% US˙mg`1\G@p2qi9p ߰_BD$Ag0""4S9Nv=yˌ%,呍y@^ɓ6 hר.b {{ꟲ@#DdDO'ҷKrkK*I49:AruK^q|m>)_*Ӣ_k6WE ÙgO7 Dp ZfKT<5LgP˟Cq[ְzhXsz=w>t:_ޒl(;L/:sɗh3;;HV¥اD$LԷ=$4  4 Y+d WϠ"@"@;vk7Zfly{8fX9;Wnnk:dMWm/HG}@ ?0 !"#01@$24P3AsGc^6P7;K-$o,h&VwZڔj9ѱM ގ|hu?[u0љZ53u_RFtF[ e~Iiu]Z ωTF^= x'6g[Mf*Sx5IDВɺd+t&听 gD,E ډı(z 2I]@{N=[@U+-첹qb֖-b o߰?Vp X zwd'z̵E \6dt) B^ |OAFtIM]d={TMPsZ7^"K#5̑hxY*dn>!t'YFzȳ= Th5]3fw kIPP(lfC~:ۗ-:};쟦ӧRU k 1+Y2O!0rv2wW`l[(ۋgP+&,Ћ.k n)FJPɉ౽rrOz,>'('d]?GUIVZ6AF0KWչN`nW΂qNB&$'"?a5tB5K;R8.a٧)BtmFI7WN\@6sLGMRsh헁vp@dﰱAS&Cn1@+ɐ xН *_ιV6o+ }3}NGr~s͛ d9-K>8gN$P"nаGNCd~f==֫qBciMI uw+%j*\oZXX` ǵc-O>VNQ4MNJ >#;Sug!_ 8vnVt\2S_HRfABu'CŃ1RdzɣsDZGDfe 蜳hKxEK QWo?r?r@ !1 "AQa#02q3@BPRbr$CS4cs?o[m-cF1q*Cbijk'M:68sq>^h^RwWj}w6Ir}s|Gb\RPf8 C |d"k,Juɭ{iMv ٓg, I#kTg&Y#[Ɯ4ܕ/ m 9l8iD,k=1 x*:c^磦էZSefXZS%np=uMB8W@n?+5] F$Tҵ , "Waeδc7#yjp_SEb9hQq _L4U(^@ZT؜a՞E~^|cf H]^1cawV?Zb#Xu7 qY!UAD4{C06Ula<+9Ǎ lN#۱ -a[0;춞ؼW]ny_ٟԳ2EҾ{3Vg 2:Oac g _,"gXՔ]E6J#x;\qf4Y6H#GKus{K.G$=⦞+w=5j^h9C'AwNX'uȹ,7P>iu* ֍Ch8#$'DȻFiՉZehuMCgE/Q1ĆEuʰlmPej4p E+ēf P7z pU45kI<%]=D=xf @:pU6SA/ nXtrk<Q+!1AQaq 0@P`?!5Ň_O|o?Mr¾%J*Tr˗?x?E/"&姤[t=;e< wJ+Beysc b;B,R˾I~zA3!7x<\*Q[۪3w^t^vJ9rfureM%'e԰WUtARRjA"dVQfn{:&a.V TYQ=3BUYT1x JV(TZTD_L\Ԧ<YK(*FhJ*"v|=c k 装#U> |(TN_( ^ճO\#W((zaU'6݁I:-]gytiIJs,W&zǼ g&tYmjˇT?DL=Al18$u෯i8(t&qe-1ɘX_.>vaѿpr 'b6+G_bƍ6U .F3|Hr%&NuE99ԦKq dw=2hI"̶D*;R=ʙͧ/$F6lAHm?PjaBc0-f`FFQ hӥPLH!? \9&CA)BF ;nQ˶*Ne6>bK*GE<;xʊɋk1,&eqX.=8K]) ޭA܎ ocy`vƊ gd8Go7 E9hњhuJ ct"濗fX) ICe(C;1zݣFjYoaTy!PԊǮa˨ҟ[yzVZZvj@ux|} 4ކOH ʌ ;Dgd̲ [vH"V"@ ,W唊V :O1M.fwփH祯TBQTRqc.[~DЏ' U=<9:]0hj邞QBijC2{nBW Z62ͻ*v}w/Xu"whhapbNI,jD ڟJ.m Ae]&e\@C27Y6DA}]X>V3fKef 7 3DK\<6r;MLNd:FL31lQ<}] l@ѦSp(0&@JlTC$}YoM@}!jK靯Y=u b<r{//vDw~)Yrr*4!j|pp']/-vc[ *hN},ԲN.C麋(&嫝&hp89j>t&UiHOV}[LЖB*hUՁ))h1}m.RzMXutf`{S8Tf0A{]{0Tu6|,' P׽p=_a6auuTD hWIFͪrTc8V!I?)ѹKW:"̄(\p{` "ʨWߑɣ8fPJ`&NlN2R=`R<JW0 :3^$@L;c aK T[ :R \7Qaq+&A{Z+}vb{V;w|DʮƇ#,397;.CV6noVd%(_2ae$h..#[9Ku k\í~y [2=v> e0hq*]j,v_1Dqzl݉jta3F^HzYrp8@ ̥n 9?0PٺQ&6A[l ̔i_2U"9@jk+ٿHCH^ʄV(S59S[(;RpK TX)EzǑv6j{KE D:5ܧ4P#9(+[ ,03qCic䏴LZ)(]6 'Nt\44/A{IkZ地0u+Cd1CR,M\pE.E@[tm9ᆴ z%OUq敉ƿq{JiΛq^(*6Ֆ~"1XJ]Ct~FʾQi>!dl^sn3 Xk| nR/LJj(Vj#`RmO,u1L 'M#`7'!Qu\ 5y23S+)T<: w!$%3|@qDr}OC5`Q \U *i-AZ=쫰Yd,i%PΡ}b1Q9,2˜0 Uc۹KT|0mYa/YgQe h')wq2WE; mMp.̣ iHt*!$J HtuoQ_S2fk Mˬ`Q-8_cIoWTre$fEl@aP 4@bVWk`~;02l>@5#:NbX`fYWddc3äPkXwcUQOw_mvٻYH+;Z'JPoް XxZ~J&#hfY]a-aӼE83)Du}R0ƒWS(ceBxDl`VhPMWRMĖHj(^/`*>N` 5\D H*J&f穹؎.,b9^{t侁F*[,jCF +Z)W Q1ʹE'G q֭Xӯ*&X^}f &K8n:yfYKP[Q^d ؾ{;Ӆz s>絵,#VG܌Jt9KΠP,Peߒ/HIN@0XQ!m=I 眷1c=[ȠY+$VU&gUFU 1`uwzR2 w#oUfcdnC9+FٓN=)F%NWK5 F^ƄVCFJ^0®^BܽÊJIi/s@+g!!v Y4jY2",;7OVލ%~5;\P_ %PgWM_҉t~%231jkP޲=3/ ZTRE =1(86t&Y5.2,nGڿqt vbk49oAFNfN]O(Z%]&q%y|㿠њ:ȕ6P(n /-z=, ( иe5oudJ; Wӯ|/7,}70̡7D[Kidam h ڔ]a||2r19©!r74D؇ޯ-Si? EfT |~p:h|G-iPqi>'ʔg .~.xZ5 nv`^uNYl[ aq.RS2ʛN!f*oY`iIL \2kXkO 53W GYxqL:5'x+R03WH%̪h4fjin^!p#r^/_@i9^^epJ! eY \k endstream endobj 23 0 obj <> /Length 3255>> stream x uiXHH@B$  #!" (,&u-*xS;ۻ]UE7"(I1$(Iu1&(I0((Iu0*(I JR%J#TAIؠ$UcpP0:(IoxP$%="(I AIj/ JR8PPáv$%-2(ImAIj+ JR8pP¡TTგT$$I*EPT'A="(A=# A Iz/AGP$oH[z+AFP$+H*z-A^GP&H&A~OPo&;H.ANԻIA}^ԇH9A}ԇI1AHꁠ"$B$uOP1APATvw#'%M7)AmI j3LJP:bRƎ6w#%%]')A(I j7HJP;:BRI jwTI ܤUdjR*33)AJKJPŦ%%rTT sTST3T#T+'%fVOJPZ9)AnRjjդ֚I Tk%%VKJPRRZ:I j$%eBRZJI j9Ԃ:'%%MJPꚔ3)A-cRZZnI jy}]= (I j5NmR2)AT*KJPS}**ʵ*[n(,EYQD(Rlg#"KQd](5VUQU?8QY"KQD*.meWª2 FQd),EU= V4E]Tʋ2 FQd)*EMS= V4EV2 EQd)*EMS= V4EϢ(EȪ>R4=9'i{R4=)j5L(XQ4(y( 2 EQd)*ER? V,r^5Î'QY"JQԏ5K̂'QY"KQdW)j~p^5IuM?OR]5IuM?(j`EMҢ(U(,xE(V@NQ&Q9ze Kvo_|;~v]W?̟vw{M~ݎo͖|/6_E;6+>߻|N_^!y4}պORfOor7/om~pƿiƿL}Eo6sA_}oi.@cv endstream endobj 24 0 obj <> /Length 21152>> stream xol[}+1IKEZ$Ʋ-˱V[^ ދ6hZl 04Rt}k 7`H jXq"d.%ٲ(K4-E=")s_+uϹ=s5 PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP++ Ν;Fl9}-iYMX DEg{Q<*<8GTATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATqϝ;wnlF7ׯ_ɛ7o.ica߾}F7v<Ťl !\.MJC0BT(.2؄k<Jb!P(# EA D(: GA? ]" AC!<ecāЇ0$Ё20TX.2b| -,dӢs"dƘ"OdhK"dra]$2Y1rȍCf(.r ,lEW"y(M@Ydr{ܹctP>lcccccceD"qƍ<\___Ƥټys}}}?gtPVdBT{O?7-ӳ{nb.ĞRR___ْI}mEn3 u 1+7:P`24 G@2#ʄ #r"ʁ> !J `I A@.at쬈=+[A###ig~9] lt`()2$tc)2 0R"d^SI)yDPD )EGfєw~k_+6o̝JjݚʀJbW("" d+}@0 B/47n$b[$)[H$w,'"+gZN*sHԍ7=ZOܽ{w}}}9?y" ڦNC0Ӄ>@ AyFo`8"}ȼ塟0 #aYzuXo,sHq\QN,/ҶmfBoģGکU5޲i1@[ 1L[= %0X˅>BDeE`9 \yoXWd^ 2"^6#@`3 kiȼ3[*2O[cӐy@'y`g=R<Чh)W2@3O7A (eo߾KטBb1%N۷n2!BqG񸩾 t-]N3H !X܌D"a/Jܷo_IcBܹs6rwmbX,/Q{lc~~^nk֬1-0::@ʇZׯ_oii1-0::bOy|}}͛B|LMM V~dתʇZˢlOy.^@nJ JdRQX.uIg:KM晧_ €iSEdaӶgO{ffPR6Bmy6k@yu [efVg˿~}2~0͆V\of4db5![iBW[S2+`v62w|,>ǣB wEe鬮5@fgވV3SsD"Zײ59yv |Tld**kkjj@s ] \K&wZ/ ZYJ|>60pVٵBQeس|23Sc ۘS5.wu]XXg Pj|>60P]Sظny7d21 c ZԹOS/!B8<DsSЄ`c7<tljykrzĭ[I!]om$T>_s4:76>w:tXBc-emsi;RMM-|V p>lC~X]]m`zrSd:)p8e׺yWndb1m*ܶ޵w  F՝ۻ6^o?ұoon% ӹz2|V3޾}[z֭[nq/iŊ>_Ffo܈L_< ޻4M|8N$?K1;谝Pl̳!ĮǼ5pt^fIK&Oݞ{?a||ܹ:ryW'Xo9c 2vu?'X8CVk={zW# o1<ٵ2 uJL'Xc3R|>&[[[7ywqeA"w}}u=S1q%8R`k wflt]c|2p|r2yTKսGMYf<;]c{k릞޽NghtNX엳T5ܙmܾus73N=;-Xg3N$ wMWNqwì!Dk&ke{YPѹ]M_4!  g l B45ttn,~I}ںu)kw]Wv]tό].׮=rE(da&.3לNW=ڃO}N3|!DWNiq\{Oƙ)nw 3-grPNwuѵ|];?yhXc~KѵFgqt3YcG}V{Vw8Mvi[3Ό;{fukYt݅d2h\.W{??{En.# ڙa,rfԚ*qr2%z !BW8ˮvWgZeڃԳ45*EqYxSqf<|(g YQ޾5㹮9/:8qYj̔?8%|r^ܭɸ/%R,=_l'Ev޾5?[ںIN%gd2!nȼ !lErc\3\tTSr|Lޅ# .J03nmt1˝65f(J"4 m3xr_k,n9T5-AD*n9~5+ٵ5U]/.Meʱ J03fhddwfSr|wbnr_hd2!n>dqjGbdѵ[/٤ufg#dt-ƥx3USu,xB,xRS.CnXi6<DŽ^r|-;-T(#'_~]e+qw&'_WnB|ttn23[XN[!# YXt ǦY`YUﮮV[7^-wkdE: ʏ̳b//OuWU*V9G2)gdśǒyQr|+ʼn6Vr|+pԄ<+)?Pe+_s8Enef ]BᎻ+|% *rː25B^mSװ܏6Jee"ssB+ 2uRr|", ̶<8:&QX9O4Be?UW+B徔&.B)kyu@}VZ 2< 0r|M*ZY8x_mH<#9:Ǧl#g7lֹSwC_He+Ǐ\ qi Urf\e9+hk\bm[>Z^=&6@V.{5͖^zJ螢^r+ۻ-=!4?vdM_[l p8-g}/d+V8NDyk\b̌k|4Ù{[\bk6he& ;]`Z\bUQY=2rloͺuy;K\;;|C*[JmZrnӦvدk Vߡ_ ?]+WVȟkjw<~]ˢF7k\篾oc}^\!<)#v=Zp8w978 oܾZM8C'y!DN̩htЯttpxFVף{Ύ/ ;x~]kaaa|<8p⸼WeZ 5M3ڝ{FwųվCr7omng<"Es+7x֍]thkl6 >:6TkYg.u㖵 gBWѹO2pty LilkL&7FD ] Lg%ԭ^ih𭭩-sf*tejrbvl$**<OZY晊ZS+7"t%ѵl3+̵=:ӥ ]Bgg]xſq_M.> ^LjZ5Fĕ85и|FG]պaK:YjX٩Е`wm-Lɪo߾݊L:q3>/mjj}Fnѹɉձ`|>6rn0pl[{"S2\8; uMM-OZ|]ᙉ++Ƶ~uЕ᳟vfט:kΜ\>:>FZb̳d2qfThBqn`M#]ںuӎܙSWl{Tʙ^_Gk ; ]iݸٿ,6Ɨ֊[;7o͸[IZsZOܺB44x;ʳkuu휜u-uv@M?'G%!۷չ/jm7t3׎ ])Y{ 6rnpdt->{:>8px8<ܷjoߺ!kY3px擁};v !B_M MױcGttO]듏دk%O>>gJՁw-ɽ.<~~]ˢ<[I$ shaa!rpMB3l66H@| p^o}r7NlfJhcut-w]GӪ$ ;:>iˮe]d1xzhta}K1ml"xk-~]qw'Ǧ m9FO !ZR}%}3c!JZY<3407q:]ZE!רu3C' n& E쳓ǒɄSWywGO{/ƦS+o!vu?XȪof,Rb/_}Ѻ֎>_xoƙENnڗ.rV;ʃ3L|>vY!DwcZ}f{֦LK+ gYȹ䬥s|r4U3M?sµv)Y>kgډҡ7}q\!B^<^nwuƙi?ޖ<+ L2XMqe77)!/ӗ^!쬕+ykO.b9CܜdkGƙzI9ʌ3i忱_恅丐\XtZswJBN{Ye'ʆ3L70+:[x2aX ǣEk)ߢe,RܫZk6wZXkgBLr|5[k"h\w8\!ѹQqd-kBEߕXf9aAp34W>wzl`ײ2E/>q];Yۺ?3" F jZ(2_Ȯպq367-p3⮧myp8rPgp߰E簾:ZYr7}vl}O$+~auuuV2݅xҺVbaA^KZIy_9,͛7򕯔sŢvW|yv-Oҵ^oI?º7qQ--o207}孊ʪFyI OO;v0=iɤ0M29ٵ$U>dBd^.N3"|1CR\rŊ&iU<O{dbb$mBTUUkʕ+ܹw*o2/Y[kҋafbŊGnپ1***nlyUyUyUyUyUymd@d@d@d@d@d@\c^uy|;F7Ǥ>m~ffy `rrRb$4= >o/(s|>.P Cmnɱ; ٳFڞ={~A!D0p<bxxX.lY{FJRwX6-25k֬Y&A#ubj*[<bddD֦i"}V;xaYj+*****|>d<޼y 4am `"'̆Taj3͛7< yh!G336qmkA6[>׿ѭ@Vi|>vJ###Ğ~s>,!֬Y×fNd4masrr2U w>:;;Ç}_9 KV~V%|><@]¦LWY)X̛vR.bZd>Lկ~5_iRH$rqsq> (* >'<2-8:Ç\<O]d<@Qڑ n%\~G>v_-yq(J˼Po޼Y^R[|> b3#EٳgWJWWF7q@d@d@d@d@v<{5(5;d Kk<*<*<*<[GG?]=744F PȐ0{ܹctF78*&'+&'+BIg$D|I6Q[miIFDmmiP(s.]Z%n{>oeh'`uaqg$kFFܣ޼H\ʕ7b--mm**XS1uFN:uȶmvzL<0+񚑑?(ٚMmm;;KeˢX~}OO,fygg$p}##:fu:^zg#Xt3:tw-;w>S,{2t,{ц#G2դPEwyw-.m۶!LD|AF7glڥڶm۷-|Pg:ͼx7| +ydnjnHfN-عss=q>(6GfiGG<)t͛ ~X32re߾gtsFӟ?~膤;~Sy晧zЏy^ 9t㏍nL_}U3s۹sw]mtC<바3i5 !>74.~#gn=ȼ⫘ZjtbrҐOF:Dѿ˿3!+Uo9񮈜ož%s0yW_u[`yȼbZ584:{7W __[1w}W_5+Kf/Yؓgx{ya{<,+;,]IK4MI`d^*&'mxoY؋FxR__yYF$ysE?o?uVr{Wn\ȼ|r%"Z[ԫۼ;&XYz`lsA xOźL iEѿۿ5"trV =rkdGGEiɝ:uw12#t*{溂gyS~_? X GC1>R5:Z{@EcrHF@d޲9#z+0:SR:uNȼek8rƵ{bSN=Y yDV^:z NP(YِypM0^]@sKye8kRIܩUPV}2 ,]Is͛5##y>9y$/ 弟i忼%p)̃WȈ嚋UBo!'1̃5ڲDAy`;vXZb P( ByyʿpCHdMWRq`d^^ܣF7\r~!CCC,l:dIyya澜_C|K.RwQGM2o1f@-7C?57{履.I&w|r|H2~Ol7o戽b:p̝^{{.8 d{Էk^q~`dҪr~k/?58w_п O~sw`HB,A|lsߢxz'NKG{{N8ښx[ŋ{{{Řf@- .{lF",ә_~z-dMьZ[[O8Og{BWW׉'=9BQG{>cf@-U̻[Pp[/}q#/$.^gVN-NH2e7}ڱ#f˼<|%֡C]/0y<!x^{l:00p=g?BhÆ[**d,e!DsEEjjV]-^yfsEKʶ[u{Ps-`W}̳-jJW߿_5Z-o.l>sw6RL-&XuС[oUxB8ȼ%^,._֊*fM??=-ko}}I/Lɳԩޗ6sChӲ݅矗?˳ l6w,bi #PVy$kxX|~ݺԵH2)ЪTu8HKY|!1-kN[[_lqʹ&Jc g!ե}ȩo9%BJa^oO{w꯯],=ɟ ٢(zK[_/g~h Oca֖+8y;w/boo -ݱZMz!}o"./([Jqu6>.x~ݺgI9qɕ%mDk- ډO?tuٮ"Vé2g?k13H2{V-_3qm1vXز^s>M+ /O?-]]]ox2i/bjlKs_yKK֖27RRON.ѧ|KI,3W\oooooog !Z[[/a <٠(6K$ʣbZ#"&usY|-n[g:t?ZDGh+: <Å`d*r{K=Oe(ʕJd< /b]]]UrsY/Byڶm[pYf,{} ~іŏGo~o FX6VIMQbׯ7 ȼ -3LuvU2KO=M92/_qoYyk_zc~ne^XNHd޲pP02oyfyD٩^6T^W婞<**B=ft+qEle}&y y6# kiw63=&v {<=x,rO=j3/@miݴVWRv;)b{LnLs[ +)Rz >k׮;w=Ӳ[ͭ?#[QrW,Bw]yn_e+_1u7n~im۶UMȼL=o~c'ju?Vȅ+t-EyjOO-RX. W(y`f,q7o_xޏcGAwmbO^7 ^ضm[޿^x28>=b '?Gr W46v'?tZcx_TCS;?EKZb--e W/U J( @ !D4tRYwttnr!("Vlb z9U@6<[A g #2 2 2 2 2 2 2 2 2 2 2 2 2ή7! glJ@!y,FTATATATATATATATATATATATAƷ! mJ><ҐyUyUyUyUyUyUyUyUyUyUyUyUy/4d@d@d@d@d@d@d@d@PB;xѭolll~~VVbѭ0XeeessѭP3ϊFFF=:222==mt[L顇ڽ{w}}mNXرc~Ȉm1z衇2-JΝ;F,4{뭷r޿?3?kb}}}}}}[P__϶_{3Gѭ}{, YoJfzzzoly԰ﭷ"7??+,mllW^!o ;# vѾ>[a1Ğ%bf=s;[o "4==Mg~~a{7(ҧC%Bc/XG d622g cD> stream xXK,' uW$8#pJUux3LL&P}R_/??,?9R 5:G bǟOǯ?2׆tVO 'aĭNk;aۄf $㛞OPYTahH3T 0 ̳baU&GO-*@mll`Vq >j?;9t)6PfLlRpdt9+vvlm;79boѳ/UÙ ؜mCG a7?9_Ά~{=#5ث9 kjfr‡}iA >.bmNVZ `Qj‡YG]˻ Ihֽxkаx~|t*F.lH?d͗= /$@4BkBDb7"LZWsGM4睨nt=Z(QՙBtDȊ ac`wT[z7+_+u>8/\C@]V ;}&ET"XہZm7;kX5ݷd¦@u}{^ѵ6S˹qsDPN4 =Ao=)$-I| (^R| =Mj sL6or!!IPd `+^؂ aml 7/4x_5n[GQ@;TG)Sؽ/d6M#[$(~iث!)8x LFjUX`҄Imث$"3ed/prz:&^,ZӘ8 Ku $e؋_1ֹ61֛sչ6ޝVo/G\t b O; KR|]=x֫dǖ>s:ĝh h\}=>k!D0%EaKyۄ k9# BIڃ}kO/ϋr`̻8*Gxһ n-L~n(>4gn /-PXhȬ (@{xl VeMz;B\}Fl㓀9,l*7[j ӂ\Fj&ը Xr4(W~ MeVSp ҈Տ ryx܏x * #ӟ@TK~ٻw"x-Poj$ofOW~F^[gq8GƛW~AN}} w6 հ0a[}l}l5[^f/R endstream endobj 26 0 obj <> endobj 27 0 obj <> stream x]ˮ,9nWTY xa Oèc¿o1Tf}9 4I$2/y-tIϿhq\okMm73N?)_8Pԛq~_>.9[j}8~M~a_?\tIz~zzmFѢWϧzK1ʡkjDmVMۿ9z?O/RbOsu]6 [nRJ*!/|kr+3ۍNr)F-v֬W-kR3wug }BYg~/Qfb Cmz3oK. Mq:.(^xr7N Ρq_Xo׷xU̿i NKb^2Rli!ܗhSE]wB&,`K~%4P񭭄h[HKCpHM\◕[2ǔ؋u^,k]Sؽ]~.5<(QVu< g}k.7u :S.45,0:XIML)[s3AbXc%t[kw4˲5!*AZڧV >.f> L '2Dm3D 26 y 'gdX9QKMڳʎGXq? 5էaP ;Q&[6& jIS} T2Jͤ:2b%*ĹìᬷN`[e1n3祡&]¦OjP'd(]MMK6YjP̑u曊*jVc|+ 'j6 9/4x@O6ҥ5s ! `9uy( {)5et 'uK(s:iF^!ZyF~|bfȯ)jKtu/6nuQֲ20U7BjaX/YR !lximf;V[٦}\8BjZ ߇h ǽ(==ɐ!iD5 .o>2s{:\2 4ߩJ_5Lf0DFoT90zTWZv L;VzQZFm)Ý^8E2$%P8IX{M4gYlTxʦ`/gqc,X_oBamټXh{0?I-/у-?}MPO{tI٫UZ|[ ?NrR ;(L^S (Fj \Q"ZK j&VS)j_HO+ @b荅z \\ZMWf.Cu ѱu1 q- dͅ`"5f>Y `-t&~b?e(<Q7: `R}{J[!_=: vCieCN&# ?!_g ퟿_b./Kן}I 4sܷC[8ZyӞ:˻?}Jupr~1Ӱ ǬUmYyJ2jFT,JiǓ?ԅ~oE7nc ,I*,ncړ[++&9[Ĉ_Ǐ&^IX#[h0܂Lȋ'?t"lOIpɌY*T_@ _Am=]3#|_i<+ # t [uM#PR $mZƕ$LzTD;-}9W^o)$֑.x,IMp\oBac /uI,/Kύʻҏ*_VFH d0&D:\VƷk;X-G^&]o,Y!%gkvFBdiHzɮ4U.)hdXjG[Ja0LY[18(,$ Q%ҫ|4*Ѣm6pipT<}KtƿжuĀ&+3b1[q٠Aˤ{*%ܝQ"DCdQ^04ugd; KV 淪ɦe@Z W/:?v‘3/$ujZ%xztz !߸p(d'l,=WD _Hp~e2 s3\h B҅TG;4Yj (zx -Ŵ:+ԙxRrJ ]CN=f<0s@n|ԭ/۴9h@'Ö33@ڍYNfHsVlS ks'Mqal|8}KNj› 0YW2Jb1Bn:K2lG/ vH;5ђ` 2CzJTr t|&k9F췽 F^hs([6;*G7M&h4, YV[YK2~H!rvxx td3![Uݤ+ΧkY+h΀#X&gf:axnLpShBfOi) wtv/ j8$0?rdEI>E|_& V.1 drF, 8/dp+^kޒ[i Y3QLd};u60uнe V%S!`yw`L4H(k5+X)nx( )$ftjT ʞ6Cb(Bb󖣺0 2J@"#C$ L#V9)d˚̰˭Q9 K*@TQa)uYwBND`,:!F1MQ&m}N}!&$fQčsi%X$U.E5s(Y lD Dx= !7rZIkur!dgq;>={j! s`j%,N ;J> ϝ+n昼m^ 1d`1੧0*ldErK#SX57uFfgXd yl.¼XNW۶/H|lIQBBºd1,!И#?EqNˑ~yֱ;)5/^шVX+XĹ3$F\yp!`s;sP_gYKr-]}dsƄy(g"A給7Cc ߎml05i Dؖ =s`1֥^Aj_\rBcmu>O!?|$_/Z;R~]22ի,_ ]KxڕS zyPmF\Hz 27%fN2/+ )H— {zZ}F)"MIg<įv=w맸E8$+@9PdYsy+I(BDfJqW8!*'c _t5YX6L+K55 y[OZu6x.#Hvz%Yk_Roh˃mt<M S a1."(Я!a[1 Dijw~~sn+ޓw+0ÜaNr>#f Vc%A*=^hc+NbU֧7$ -Zr\ Qix M|X:"|KfP@'bY[#q+ .]FpMRnRyJji8œ"*Bd<.BFKT{oD*~"OahA`Z~?k|$ m)?(y_87`WNٱ+ds&Rr{tHC N?NSpq+qӝ΋gމCT^ w4vϞY{A>V᷐}-9vK"uۗ=J߼)xՀ0zg)HI}] ' 2fPu9}5m!c?B>S2X2%]qGױꉗr%έ$7U l.6ڽebwY4K0j8ܼN ֆXO~m~@yʾF'#o!BVW_k}N-J|YUs<+RN:[]b'4\=+]ڨچ)Jǜ~IRN΅t|ˏ-۷3o~+>_wܪ߬㍎O>v㕟8زV| !t<>}nu[04e G(?,x !=t|;wY֌$ ʏ2q6dY~O\)Tˏl;_e?M$0P1Ԏ}gP P?.N>4G*p!Gc'7RS@v'8V)Y o{}_W~2| %S@31W+>tPŞҘ@l",(NgQ7Xp1;2yS|Wȍ2b3?#֥d,3ua2lLLx,X9-,ٿљ6*d7b3g}e8;*1?N| <s C> endobj 2 0 obj <> /ExtGState << /GS1 5 0 R /GS2 6 0 R /GS3 7 0 R >> /XObject << /I1 22 0 R /I2 23 0 R /I3 24 0 R /FO1 25 0 R /FO2 27 0 R >> >> endobj 29 0 obj << /Producer (mPDF 8.0.5) /Title (Szl-FnyerQ-HQmrsklet rzkelQ) /CreationDate (D:20200710171014+00'00') /ModDate (D:20200710171014+00'00') >> endobj 30 0 obj << /Type /Catalog /Pages 1 0 R /OpenAction [3 0 R /XYZ null null 1] /PageLayout /OneColumn >> endobj xref 0 31 0000000000 65535 f 0000001135 00000 n 0000070026 00000 n 0000000030 00000 n 0000000238 00000 n 0000001224 00000 n 0000001285 00000 n 0000001340 00000 n 0000001395 00000 n 0000001545 00000 n 0000002574 00000 n 0000002970 00000 n 0000003039 00000 n 0000003346 00000 n 0000003769 00000 n 0000012618 00000 n 0000012774 00000 n 0000013773 00000 n 0000014169 00000 n 0000014238 00000 n 0000014548 00000 n 0000014941 00000 n 0000023521 00000 n 0000035414 00000 n 0000038913 00000 n 0000060323 00000 n 0000062337 00000 n 0000062388 00000 n 0000069975 00000 n 0000070247 00000 n 0000070457 00000 n trailer << /Size 31 /Root 30 0 R /Info 29 0 R /ID [<58357d4337dba0c7d4459b6cc458b8bc> <58357d4337dba0c7d4459b6cc458b8bc>] >> startxref 70567 %%EOF